Regulation of Parathyroid Hormone Gene Expression by Dihydroxyvitamin D


Vitamin D’s active metabolite 1,25(OH)2D3 acts on the parathyroid to markedly decrease PTH gene transcription.

It does this by binding to its specific receptor in the parathyroid which then binds to a defined sequence, the vitamin D response element (VDRE) in the parathyroid hormone (PTH) gene promoter.

Retinoic acid amplifies the effect of 1,25(OH)2D3 to decrease PTH mRNA levels suggesting that a VDR-RXR heterodimer binds to the VDRE.

1,25(OH)2D3 may amplify its effect on the PTH gene by increasing the concentration of the VDR and the calcium receptor (CaR) in the parathyroid.

Calreticulin prevents the binding of the VDR to the VDRE.

The effect of 1,25(OH)2D3 to decrease the synthesis and secretion of PTH is used therapeutically to prevent the secondary hyperparathyroidism of patients with chronic renal failure.

Transcriptional Regulation of the PTH Gene by 1,25(OH)2D3

The action of 1,25(OH)2D3 or its analogues to decrease PTH secretion is now a well-established axiom in clinical medicine for the suppression of the secondary hyperparathyroidism of patients in chronic renal failure. So much so, that it is worthwhile to reflect upon its scientific basis.

That is the purpose of the present review.

There have been more recent developments spurred by pharmaceutical companies to discover drugs that have more selective actions on the parathyroid. PTH regulates serum concentrations of calcium and phosphate, which, in turn, regulate the synthesis and secretion of PTH.

1,25-dihydroxyvitamin D (1,25(OH)2D3) or calcitriol has independent effects on calcium and phosphate levels, and also participates in a well defined feedback loop between calcitriol and PTH.

PTH increases the renal synthesis of calcitriol. Calcitriol then increases blood calcium largely by increasing the efficiency of intestinal calcium absorption.

Calcitriol also potently decreases the transcription of the PTH gene.

This action was first demonstrated in vitro in bovine parathyroid cells in primary culture, where calcitriol led to a marked decrease in PTH mRNA levels and a consequent decrease in PTH secretion.

The physiological relevance of these findings was established by in vivo studies in rats.

The localization of the VDR mRNA to the parathyroids was demonstrated by in situ hybridization studies of the thyro-parathyroid and duodenum.

VDR mRNA was localized to the parathyroids in the same concentration as in the duodenum, calcitriol’s classic target organ.

Rats injected with amounts of calcitriol which did not increase serum calcium had marked decreases in PTH mRNA levels, reaching <4% of control at 48 hours.

There was also a decrease in calcitonin mRNA levels in these rats.

The effect of 1,25(OH)2D3 on the PTH and calcitonin genes was shown to be transcriptional both in in vivo studies in rats and in in vitro studies with primary cultures of bovine parathyroid cells.

Interestingly, in rats given large doses of vitamin D with a resultant hypercalcemia there was still a decrease in calcitonin mRNA levels despite the elevated serum calcium which is a secretagogue for calcitonin. When 684 base pairs of the 5'-flanking region of the human PTH gene was linked to a reporter gene and transfected into a rat pituitary cell line (GH4C1), gene expression was lowered by 1,25(OH)2D3.

These studies suggest that 1,25(OH)2D3 decreases PTH transcription by acting on the 5'-flanking region of the PTH gene. The effect of 1,25(OH)2D3 may involve heterodimerization with the retinoid acid recptor.

This is because, 9 cis-retinoic acid, which binds to the retinoic acid receptor, when added to bovine parathyroid cells in primary culture, led to a decrease in PTH mRNA levels. Moreover, combined treatment with 1x10-6 M retinoic acid and 1x10-8 M 1,25(OH)2D3 more effectively decreased PTH secretion and preproPTH mRNA than did either compound alone.

Alternatively, retinoic acid receptors might synergize with VDRs through actions on distinct sequences.

1,25(OH)2D3 negatively regulates expression of the avian PTH (aPTH) gene transcript, and Liu et al identified a vitamin D response element (VDRE) near the promoter of the aPTH gene.

Koszewski et al converted the negative activity imparted by the aPTH VDRE to a positive transcriptional response through selective mutations introduced into the element.

The tested sequences were derived from individual and combined mutations to 2 bp in the 3'-half of the direct repeat element, GGGTCAggaGGGTGT.

Cold competition experiments using mutant and wild-type oligonucleotides in the mobility shift assay revealed minor differences in the ability of any of these sequences to compete for binding to a heterodimer complex comprised of recombinant proteins.

Ethylation interference footprint analysis for each of the mutants produced unique patterns over the 3'-half-sites that were distinct from the weak, wild-type footprint.

Transcriptional outcomes evaluated from a chloramphenicol acetyltransferase reporter construct utilizing the aPTH promoter found that the individual T->A mutant produced an attenuated negative transcriptional response while the G->C mutant resulted in a reproducibly weak positive transcriptional outcome.

The double mutant, however, yielded a 4-fold increase in transcription, similar to the 7-fold increase observed from an analogous construct using the human osteocalcin VDRE.

UV light crosslinking to gapped oligonucleotides assessed the polarity of heterodimer binding to the wild-type and double mutant sequences and was consistent with the vitamin D receptor preferentially binding to the 5'-half of both elements.

Finally, DNA affinity chromatography was used to immobilize heterodimer complexes bound to the wild-type and double mutant sequences as bait to identify proteins that may preferentially interact with these DNA-bound heterodimers.

This analysis revealed the presence of a p160 protein that specifically interacted with the heterodimer bound to the wild-type VDRE, but was absent from complexes bound to response elements associated with positive transcriptional activity.

Thus, the sequence of the individual VDRE appears to play an active role in dictating transcriptional responses that may be mediated by altering the ability of a vitamin D receptor heterodimer to interact with accessory factor proteins.

Darwish et al identified a transcription factor that binds to the promoter region of the human PTH gene adjacent to the negative vitamin D responsive element (VDRE).

Deletion and mutation analysis revealed that the binding site for this factor overlapped with the proximal repeat element of the VDRE.

It includes additional nucleotides at the 3' end of the VDRE.

This site has the sequence TTTGAACCTATAGTTGAGAT and a core sequence TGAACCTAT needed for binding of the factor.

Experiments with specific anti-vitamin D receptor (VDR) antibodies demonstrated that VDR is not found in the factor/DNA complex.

However, removing the VDR from the nuclear extract by immunoprecipitation eliminated the binding complex, and the addition of recombinant VDR to the depleted extract did not restore the factor’s ability to bind to the DNA, suggesting that the factor and VDR are closely associated.

Transfection experiments with various reporter constructs indicated that the factor is required for the high transcriptional activity of the human PTH gene.

This high activity is significantly suppressed by 1,25(OH)2D3.

This factor is expressed in several cell types including rat osteoblasts and pituitary.

Kimmel-Jehan et al have shown that the vitamin D receptor-retinoid X receptor (VDR-RXR) heterodimers induces a DNA bend upon binding to various vitamin D response elements (VDRE) by circular permutation and phasing analysis.

The VDREs used included the hPTH gene. As shown by circular permutation analysis, VDR-RXR induced a distortion in DNA fragments containing various VDREs.

The distortions took place with or without a 1,25-(OH)2D3 ligand.

The centers of the apparent bend were found in the vicinity of the midpoint of the VDRE. Phasing analysis revealed that VDR-RXR heterodimers induced a directed bend of 26 degrees, not influenced by the presence of hormone.

Therefore, similar to other members of the steroid and thyroid nuclear receptor superfamily, VDR-RXR heterodimers induce DNA bending.

A further level at which 1,25(OH)2D3 might regulate the PTH gene would be at the level of the 1,25(OH)2D3 receptor. 1,25(OH)2D3 acts on its target tissues by binding to the 1,25(OH)2D3 receptor, which regulates the transcription of genes with the appropriate recognition sequences.

The concentration of the 1,25(OH)2D3 receptor in the 1,25(OH)2D3 target sites could allow a modulation of the 1,25(OH)2D3 effect, with an increase in receptor concentration leading to an amplification of its effect and a decrease in receptor concentration dampening the 1,25(OH)2D3 effect.

Naveh-Many et al injected 1,25(OH)2D3 to rats and measured the levels of the 1,25(OH)2D3 receptor mRNA (VDRmRNA) and PTHmRNA in the parathyro-thyroid tissue.

They showed that 1,25(OH)2D3 in physiologically relevant doses led to an increase in VDRmRNA levels in the parathyroid glands in contrast to the decrease in PTH mRNA levels.

This increase in VDR mRNA occurred after a time lag of 6 h, and a dose response showed a peak at 25 pmol.

Weanling rats fed a diet deficient in calcium were markedly hypocalcemic at 3 weeks and had very high serum 1,25(OH)2D3 levels.

Despite the chronically high serum 1,25(OH)2D3 levels there was no increase in VDR mRNA levels, and furthermore PTH mRNA levels did not fall and were markedly increased.

The low calcium may have prevented the increase in parathyroid VDR levels and this may partially explain the PTH mRNA suppression.

Whatever the mechanism, the lack of suppression of PTH synthesis in the setting of hypocalcemia and increased serum 1,25(OH)2D3 is crucial physiologically, because it allows an increase in both PTH and 1,25(OH)2D3 at a time of chronic hypocalcemic stress.

Russell et al studied the parathyroids of chicks with vitamin D deficiency and confirmed that 1,25(OH)2D3 regulates PTH and VDR gene expression in the avian parathyroid gland.

The chicks in this study were fed a vitamin D deficient diet from birth for 21 days and had established secondary hyperparathyroidism.

These hypocalcemic chicks were then fed a diet with different calcium contents (0.5, 1.0 and 1.6%) for 6 days.

The serum calciums were all still low (5, 6 and 7 mg/dl) with the expected inverse relationship between PTH mRNA and serum calcium.

There was also a direct relationship between serum calcium and VDR mRNA levels. This result suggests either that VDR mRNA was not upregulated in the setting of secondary hyperparathroidism or that calcium directly regulates the VDR gene.

Garfia et al injected a small dose of 1,25(OH)2D3 to hypercalcemic rats to match the serum 1,25(OH)2D3 levels of hypocalcemic rats. Parathyroid gland VDR mRNA and VDR protein were increased in hypercalcemic rats as compared with hypocalcemic rats.

Increasing doses of 1,25(OH)2D3 upregulated VDR mRNA and VDR only in hypercalcemic rats.

Additional experiments showed that the decrease in VDR in hypocalcemic rats prevented the inhibitory effect of 1,25(OH)2D3 on PTH mRNA.

They concluded that extracellular Ca regulates VDR expression by parathyroid cells independently of 1,25(OH)2D3 and that by this mechanism hypocalcemia may help prevent the feedback of 1,25(OH)2D3 on the parathyroids.

Brown et al studied vitamin D deficient rats and confirmed that 1,25(OH)2D3 upregulated the parathyroid VDR mRNA and that in secondary hyperparathyroidism with hypocalcemia the PTH mRNA was upregulated without change in the VDR mRNA.

All these studies show that 1,25(OH)2D3 increases the expression of its receptor’s gene in the parathyroid gland, which would result in increased VDR protein synthesis and increased binding of 1,25(OH)2D3.

This ligand-dependent receptor upregulation would lead to an amplified effect of 1,25(OH)2D3 on the PTH gene, and might help explain the dramatic effect of 1,25(OH)2D3 on the PTH gene.

Koszewski et al studied by interference footprinting protocols the interactions of the vitamin D receptor (VDR) with either a positive or a negative VDRE.

A sequence from the human osteocalcin (hOC) gene was chosen for the prototypical positive VDRE, while an analogous sequence linked to the avian parathyroid hormone gene (aPTH) was used as the negative VDRE.

Both types of response elements were examined for phosphate backbone contacts, as well as base-specific interactions with guanine and thymine residues.

Sources of VDR included partially purified canine intestinal preparations, as well as extracts of recombinant human VDR and retinoid X receptor alpha prepared from baculovirus-infected Sf insect cells.

Cold competition experiments using variable amounts of these oligonucleotides in the mobility shift assay revealed that the hOC element was a five-fold better competitor for heterodimer complex binding than the negative VDRE.

Interference footprints revealed extensive strong contacts to the phosphate backbone and individual guanine and thymine nucleotides of the hOC element.

The composite hOC footprint was asymmetric for the number and strength of interactions observed over each of the respective direct repeat half-sites.

In contrast, the aPTH VDRE footprints revealed fewer points of DNA contact that were limited to the hexanucleotide repeat regions and were strikingly weaker in nature. The alignment of DNA contact points for both elements produced a 5' stagger that was indicative of successive major groove interactions, and consistent with dimer binding.

DNA helical representations indicate that the heterodimer contacts to these response elements are substantially different and provide insight into functional aspects of each complex.

To determine what phenotypic abnormalities observed in vitamin D receptor (VDR)-ablated mice are secondary to impaired intestinal calcium absorption rather than receptor deficiency, Li et al normalized mineral ion levels by dietary means.

VDR-ablated mice and control littermates were fed a diet rich in calcium lactate that has been shown to prevent secondary hyperparathyroidism in vitamin D-deficient rats. This diet normalized growth and random serum ionized calcium levels in the VDR- ablated mice.

The correction of ionized calcium levels prevented the development of parathyroid hyperplasia and the increases in PTH mRNA synthesis and in serum PTH levels. VDR-ablated animals fed this diet did not develop rickets or osteomalacia.

However, alopecia was still observed in the VDR-ablated mice with normal mineral ions, suggesting that the VDR is required for normal hair growth.

This study demonstrates that normalization of mineral ion homeostasis can prevent the development of hyperparathyroidism, osteomalacia, and rickets in the absence of the genomic actions of 1,25-dihydroxyvitamin D3.

Van Cromphaut et al have also generated mice with deletions of the VDR and showed that the secondary hyperparathyroidism of these VDR-KO mice could be corrected by a high calcium diet.

Vitamin D may also amplify its effect on the parathyroid by increasing the activity of the calcium receptor (CaR).

Canaff et al showed that in fact there are VDREs in the human CaR’s promoter.

The calcium-sensing receptor (CaR), expressed in parathyroid chief cells, thyroid C-cells, and cells of the kidney tubule, is essential for maintenance of calcium homeostasis. They showed that parathyroid, thyroid, and kidney CaR mRNA levels increased 2-fold at 15 h after intraperitoneal injection of 1,25(OH)2D3 in rats.

Human thyroid C-cell (TT) and kidney proximal tubule cell (HKC) CaR gene transcription increased approximately 2-fold at 8 and 12 h after 1,25(OH)2D3 treatment.

The human CaR gene has two promoters yielding alternative transcripts containing either exon 1A or exon 1B 5'-untranslated region sequences that splice to exon 2 some 242 bp before the ATG translation start site.

Transcriptional start sites were identified in parathyroid gland and TT cells; that for promoter P1 lies 27 bp downstream of a TATA box, whereas that for promoter P2, which lacks a TATA box, lies in a GC-rich region.

In HKC cells, transcriptional activity of a P1 reporter gene construct was 11-fold and of P2 was 33-fold above basal levels. 10-8 M 1,25(OH)2D3 stimulated P1 activity 2-fold and P2 activity 2.5-fold.

Vitamin D response elements (VDREs), in which half-sites (6 bp) are separated by three nucleotides, were identified in both promoters and shown to confer 1,25(OH)2D3 responsiveness to a heterologous promoter.

This responsiveness was lost when the VDREs were mutated.

In electrophoretic mobility shift assays with either in vitro transcribed/ translated vitamin D receptor and retinoid X receptor-alpha, or HKC nuclear extract, specific protein-DNA complexes were formed in the presence of 1,25(OH)2D3 on oligonucleotides representing the P1 and P2 VDREs.

In summary, functional VDREs have been identified in the CaR gene and provide the mechanism whereby 1,25(OH)2D3 up-regulates parathyroid, thyroid C-cell, and kidney CASR expression.

The use of calcitriol is limited by its hypercalcemic effect, and therefore a number of calcitriol analogs have been synthesized which are biologically active but are less hypercalcemic than calcitriol.

The ability of calcitriol to decrease PTH gene transcription is used therapeutically in the management of patients with chronic renal failure.

They are treated with calcitriol in order to prevent the secondary hyperparathyroidism of chronic renal failure.

The poor response in some patients who do not respond, may well result from poor control of serum phosphate, decreased vitamin D receptor concentration, an inhibitory effect of a uremic toxin(s) on VDR-VDRE binding. or tertiary hyperparathyroidism with monoclonal parathyroid tumors.

Patel et al have studied the mechanism of the resistance to the action of calcitriol in chronic renal failure.

They used the electrophoretic mobility shift assay to compare the ability of VDRs from normal and renal failure rats to bind to the osteocalcin gene VDRE.

VDRs from renal failure rats had only half the DNA binding capacity as VDRs from control rats, despite identical calcitriol binding. Furthermore, incubation of normal VDRs with a uremic plasma ultrafiltrate resulted in a loss of > 50% of the binding sites for the osteocalcin VDRE.

The inhibitory effect of the uremic ultrafiltrate was due to a specific interaction with the VDR, not retinoid X receptors. They concluded that an inhibitory effect of a uremic toxin(s) on VDR-VDRE binding could underlie the calcitriol resistance of renal failure.

Calreticulin and the Action of 1,25(OH)2D3 on the PTH Gene

Another possible level at which 1,25(OH)2D3 might regulate PTH gene expression involves calreticulin.

Calreticulin is a calcium binding protein which is present in the endoplasmic reticulum of the cell, and also may have a nuclear function.

It regulates gene transcription via its ability to bind a protein motif in the DNA-binding domain of nuclear hormone receptors of sterol hormones.

It has been shown to prevent vitamin D’s binding and action on the osteocalcin gene in vitro. Sela-Brown et al showed that calreticulin might inhibit vitamin D’s action on the PTH gene.

Both rat and chicken VDRE sequences of the PTH gene were incubated with recombinant VDR and retinoic acid receptor (RXR) proteins in a gel retardation assay and showed a clear retarded band.

Purified calreticulin inhibited binding of the VDR-RXR complex to the VDREs in gel retardation assays.

This inhibition was due to direct protein- protein interactions between the VDR and calreticulin.

Opossum kidney (OK) cells were transiently cotransfected with calreticulin expression vectors (sense and antisense) and either rat or chicken PTH gene promoter-CAT constructs.

The cells were then assayed for 1,25(OH)2D3-induced CAT gene expression.

1,25(OH)2D3 decreased PTH promoter-CAT transcription.

Cotransfection with sense calreticulin, which increases calreticulin protein levels, completely inhibited the effect of 1,25(OH)2D3 on the PTH promoters of both rat and chicken.

Cotransfection with the antisense calreticulin construct did not interfere with vitamin D’s effect on PTH gene transcription. Sense calreticulin expression had no effect on basal CAT mRNA levels.

In order to determine a physiological role for calreticulin in the regulation of the PTH gene, the levels of calreticulin protein were determined in the nuclear fraction of rat parathyroids.

The rats were fed either a control diet or a low calcium diet, which leads to increased PTH mRNA levels despite high serum 1,25(OH)2D3 levels that would be expected to inhibit PTH gene transcription.

It was postulated that high calreticulin levels in the nuclear fraction would prevent the effect of 1,25(OH)2D3 on the PTH gene.

In fact, the hypocalcemic rats had increased levels of calreticulin protein, as measured by Western blots, in their parathyroid nuclear faction.

This may help explain why hypocalcemia leads to increased PTH gene expression despite high serum 1,25(OH)2D3 levels, and may also be relevant to the refractoriness of the secondary hyperparathyroidism of many chronic renal failure patients to 1,25(OH)2D3 treatment.

These studies, therefore, indicate a role for calreticulin in regulating the effect of vitamin D on the PTH gene, and suggest a physiological relevance to these studies.

PTH Degradation

A further level of control of serum PTH is at the level of PTH degradation.

Preproparathyroid hormone (prepro-PTH) is abundantly synthesized by parathyroid chief cells; yet under normal growth conditions, little or no prepro-PTH can be detected in these cells.

The addition of proteasome inhibitors to primary cultures of bovine PT cells caused the accumulation of prepro-PTH and pro-PTH. Proteasome-mediated degradation of PTH precursors therefore may be important in the regulation of the levels of these precursors and hence PTH secretion.

However, it is not known whether calcium or vitamin D regulate this process.

PTH may be degraded in the parathyroid to carboxy and amino terminal fragments in both the parathyroid as well as in other organs such as the liver and kidney. In the situation of hypercalcemia as much as 90% of the synthesized PTH may be degraded.

Enzymes that are involved include furin and protein convertase 1, 2 and 7 which are all expressed in the PT.

However, both calcium and 1,25(OH)2D3 did not regulate furin or protein convertase 7 mRNA levels.

Secondary Hyperparathyroidism and Parathyroid Cell Proliferation

Chronic changes in the physiological milieu often lead to both changes in parathyroid cell proliferation and PTH gene regulation, as discussed by Silver et al. In such complicated settings, the regulation of PTH gene expression may well be controlled by mechanisms that differ from those in non-proliferating cells.

Further, the effects of change in cell number and activity of individual cells can be complicated and difficult to dissect. Nevertheless, such chronic changes represent commonly observed clinical circumstances that require examination.

The expression and regulation of the PTH gene has been studied in two models of secondary hyperparathyroidism: (1) rats with experimental uremia due to 5/6 nephrectomy and (2) rats with nutritional secondary hyperparathyroidism due to diets deficient in vitamin D and/or calcium.

Rats with 5/6 nephrectomy had higher serum creatinine levels and also appreciably higher levels of parathyroid gland PTH mRNA. Their PTH mRNA levels decreased after single injections of 1,25(OH)2D3, a response similar to that of normal rats. Interestingly, the secondary hyperparathyroidism is characterized by an increase in parathyroid gland PTH mRNA but not in VDR mRNA.

This suggests that in 5/6 nephrectomy rats there is relatively less VDR mRNA per parathyroid cell, or a relative down-regulation of the VDR, as has been reported in VDR binding studies.

The second model of experimental secondary hyperparathyroidism studied was that due to dietary deficiency of vitamin D (-D) and/or calcium (-Ca), as compared to normal vitamin D (ND) and normal calcium (NCa).

These dietary regimes were selected to mimic the secondary hyperparathyroidism in which the stimuli for the production of hyperparathyroidism are the low serum levels of 1,25(OH)2D3 and ionized calcium. Weanling rats were maintained on the diets for 3 weeks and then studied.

Rats on diets deficient in both vitamin D and calcium (-D, -Ca) exhibited a 10-fold increase in PTH mRNA as compared to controls (ND, NCa) together with much lower serum calcium levels and also lower serum 1,25(OH)2D3 levels. Calcium deficiency alone (-Ca, ND) led to a 5-fold increase in PTH mRNA levels, whereas a diet deficient in vitamin D alone (-D, NCa) led to a 2-fold increase in PTH mRNA levels.

Because renal failure and prolonged changes in blood calcium and 1,25(OH)2D3 can affect both parathyroid cell number and the activity of each parathyroid cell, the change in both these parameters must be assessed in each model in order to understand the various mechanisms of secondary hyperparathyroidism.

Parathyroid cell number was determined in thyroparathyroid tissue of normal rats and -D, -Ca rats.

To do this, the tissue was enzymatically digested into an isolated cell population, which was then passed through a flow cytometer [fluorescence-activated cell sorter (FACS)] and separated by size into two peaks.

The first peak of smaller cells contained parathyroid cells as determined by the presence of PTH mRNA, and the second peak contained thyroid follicular cells and calcitonin-producing cells that hybridized positively for thyroglobulin mRNA and calcitonin mRNA but not PTH mRNA.

There was a 1.6-fold increase in cells from the -D, -Ca rats than from the normal rats, and a 10-fold increase in PTH mRNA.

Therefore, this model of secondary hyperparathyroidism is characterized by increased gene expression per cell, together with a smaller increase in cell number.

Further studies by Naveh-Many et al have clearly demonstrated that hypocalcemia is a stimulus for parathyroid cell proliferation.

They studied parathyroid cell proliferation by staining for proliferating cell nuclear antigen (PCNA) and found that a low calcium diet led to increased levels of PTH mRNA and a 10-fold increase in parathyroid cell proliferation.

The secondary hyperparathyroidism of 5/6 nephrectomized rats was characterized by an increase in both PTH mRNA levels and PCNA-positive parathyroid cells.

Therefore, both hypocalcemia and uremia induce parathyroid cell proliferation in vivo.

The effect of 1,25(OH)2D3 on parathyroid cell proliferation was also studied in this dietary model of secondary hyperparathyroidism.

1,25(OH)2D3 at a dose (25 pmol for 3 days) that lowered PTH mRNA levels had no effect on the number of PCNA-positive cells.

Higher doses (100 pmol for 7 days) dramatically decreased the the number of proliferating cells (unpublished). These findings emphasize the importance of a normal calcium in the prevention of parathyroid cell hyperplasia.

The importance of the CaR to PT cell proliferation is also evident in that the calcimimetic NPS R-568 largely prevents the PT cell proliferation in rats with experimental uremia. However, the role of the CaR is not that clear in view of the interesting findings of Lewin et al.

Experimental severe secondary hyperparathyroidism (HPT) is reversed within 1 wk after reversal of uremia by an isogenic kidney transplantation in uremic rats. In view of the reports that abnormal PTH secretion in uremia is related to down-regulation of CaR and vitamin D receptor (VDR) in the parathyroid glands, they studied the expression of CaR and VDR genes after reversal of uremia and hyperparathyroidism in rats given isogenic kidney transplantation.

After kidney transplantation previously uremic rats, the secondary hyperparathyroidism was reversed with normal serum PTH levels.

However, both CaR mRNA and VDR mRNA remained severely reduced (CaR, 39 +/- 7%; VDR, 9 +/- 3%; P < 0.01) compared with normal rats.

In conclusion, circulating plasma PTH levels normalized rapidly after kidney transplantation, despite persisting down-regulation of CaR and VDR gene expression.

This indicates that up-regulation of CaR mRNA and VDR mRNA is not necessary to induce the rapid normalization of PTH secretion from hyperplastic parathyroid glands.

In addition, Imanishi et al created transgenic mice with the cyclin D1 gene specifically targeted to the parathyroid. In the parathyroids of these rats with hyperparathyroidism there was a down-regulation of the CaR.

These results indicate that the changes in the CaR may be secondary to the proliferative state and not causative.

In patients with both primary and nodular secondary hyperparathyroidism due to chronic renal failure there is a decrease in VDR mRNA and protein levels. In hyperparathyroidism there is a decrease in the cyclin kinase inhibitors p21 and p27 with an increase in TGFα in the parathyroids.

Treatment with vitamin D metabolites increase p21 levels and prevent the decrease in TGFα levels and prevent the parathyroid cell proliferation.

Conclusion

PTH gene expression is powerfully regulated by 1,25(OH)2D3.

This is a transcriptional effect and results in a marked decrease in PTH secretion and serum PTH.

The effect of 1,25(OH)2D3 on the parathyroid is used in the treatment of many patients in chronic renal failure to prevent secondary hyperparathyroidism.





This article comes from Medical Encyclopedia

The URL for this story is: http://www.medicine-encyclopedia.net/sections-41-Regulation-of-Parathyroid-Hormone-Gene-Expression-by-Dihydroxyvitamin-D.html